circad | circRNAs associated with diseases

circPVT1
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Non-Small Cell Lung Cancer	ICD-10	#N/A (C34)
DBLink	Link to database	PMID	30590312
Experimental Method
Sample Type	Serum, tissue samples and cell lines	Comparison	forty-five serum samples, sixty-eight cancer tissues and paired adjacent noncancerous tissues from primary NSCLC patients were collected
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGACTCTTCCTGGTGAAGCATCTGAT Reverse TACTTGAACGAAGCTCCATGCAGC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Qin, S, Zhao, Y, Lim, G, Lin, H, Zhang, X, Zhang, X (2019). Circular RNA PVT1 acts as a competing endogenous RNA for miR-497 in promoting non-small cell lung cancer progression. Biomed. Pharmacother., 111:244-250.